Article Text

PDF

CORRECTION

Statistics from Altmetric.com

Michell A W, Raha S K, Barker R A, et al. A case of late onset sporadic Parkinson’s disease with an A53T mutation in α-synuclein (J Neurol Neurosurg Psychiatry 2005;76:596–7).

The authors wish to correct a typographical error in the primer sequence provided for exon 3. The NCBI database accession number was U46898 (HSACP03); primer pairs designed to amplify exon 3 were 3F: GAGGACCTCCTGTTAGCTGG, and 3R: GACTGATATGTTCTTAGAATGCTC.

In addition the order of authorship is incorrect. Dr Raha-Chowdhury should be in the senior (last) author position.

View Abstract

Request permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

Linked Articles