A pseudo-Argyll Robertson pupil is a neurological sign indicating a normal near reflex but the absence of a light reflex (light-near dissociation), a lack of miosis, and pupil irregularity. It has been reported in patients with diabetes mellitus, multiple sclerosis, Wernicke’s encephalopathy, sarcoidosis, tumours, and haemorrhage.1 Although the appearance of pseudo-Argyll Robertson pupil is very similar to Holmes-Adie pupil, the first is distinguishable from the second by the location of lesions and pharmacological response. The responsible lesion in pseudo-Argyll Robertson pupil is in the central region, whereas that of Holmes-Adie pupil is peripheral. Dilute pilocarpine constricts the pupils of patients with Holmes-Adie pupil, but it is not effective in patients with pseudo-Argyll Robertson pupil. We present a patient with spinocerebellar ataxia type 1 (SCA1) and her asymptomatic younger brother who both exhibited pseudo-Argyll Robertson pupil.

Patient 1 was a 21 year old woman who complained of gait instability in 1996. Thereafter, she noticed difficulties in speech and in the fine movement of her hands. Her mother had had gait disturbance since her 20s and died of pneumonia at the age of 35. The condition of our patient deteriorated gradually, and she was admitted to our hospital in April, 1997. Neurological examination showed bilateral mydriasis (7.0 mm in diameter) and light-near dissociation (figure). Although the light reflex was absent, the near reflex was normal. The extraocular movements were saccadic and the upper gaze of both eyes was slightly limited. Optokinetic nystagmus was absent. Her tongue showed atrophy and fasciculation. The distal muscles of the limbs were slightly weak, although muscle tone was normal. The deep tendon reflexes were augmented in her upper and lower limbs. Babinski’s and Chaddock’s signs were positive on both sides. The sensory system was normal. Her speech was ataxic; slight limb ataxia was detected in the limbs; and her gait was wide based and ataxic. Blood and urine laboratory findings were normal. Her pupils reacted to 1% pilocarpine, but not to 0.2% pilocarpine. Brain MRI showed remarkable atrophy of the cerebellum and a slight atrophy of the pontine tegmentum.⁹⁹mTechnetium-hexamethylpropyleneamine oxime (^99mTc-HMPAO) SPECT disclosed a hypoperfusion of the cerebellar vermis, pons, and basal ganglia.

• Download figure
• Open in new tab
• Download powerpoint

Light-near dissociation in the left eye of the sister. (A) The light reflex was absent. (B) A steady gaze on the marker in front of her nose induced the convergence and accomodation reflexes.

Patient 2 was a 20 year old man, the brother of patient 1. He consulted our clinic for examination, although he had not experienced any neurological problems. He received dialysis three times a week because he had renal failure due to pyelonephritis. On examination, he presented pupillary abnormalities which were similar to those of patient 1 (mydriasis; 6.5 mm, light-near dissociation). Although the light reflex was absent, the near reflex was normal. His upward gaze was slightly limited. Fasciculation was noted on his tongue. The distal portion of the upper limbs was slightly weak and the deep tendon reflexes in the limbs were slightly accentuated. Babinski’s sign was positive in both feet, although there were no signs of spastic or ataxic movement in his limbs and in his gait. Their father showed no abnormalities on neurological examination.

Blood was collected for molecular studies with informed consent from both patients and their father. Total DNA was extracted by the phenol/chloroform method from peripheral blood leucocytes. To detect CAG expansion in the SCA1 region, we performed a polymerase chain reaction (PCR) with Rep-2 (5′ CAACATGGGCAGTCTGAG 3′) and Rep-1 (5′ AACTGGAAATGTGGGCGTAC 3′) according to Orr et al.2 The products of PCR were separated by electrophoresis (2% agarose) with ethidium bromide staining. Patients 1 and 2 showed the CAG repeat expansion in the SCA1 gene. A sequencing analysis for patient 1 indicated a CAG repeat number of 60/27 (Dr Igarashi, Niigata University).

Pupillary reactions are divided into light reflexes and near reflexes. The light reflex pathway reaches the Edinger-Westphal nucleus through the pretectal nucleus . The near reflex consists of both the convergence reflex and the accommodation reflex. Their pathways are different from that of the light reflex until they reach the Edinger-Westphal nucleus. Therefore, it may be that the lesion for light-near dissociation is located between the pretectal nucleus and the Edinger-Westphal nucleus. Although the pupillary diameter is reduced in the Argyll Robertson pupil, mydriasis was seen in our patients. A patient with similar pupillary abnormalities (pseudo-Argyll Robertson pupil) has been reported by Olsen et al.3 The causative disorder of the patient reported by Olsen et al 3 was congenital oculomotor paralysis. They attributed the pupillary abnormalities to the aberrant regeneration of the oculomotor nerve. In Holmes-Adie pupil, the reaction to a parasympathomimetic agent (0.2% pilocarpine) can usually be confirmed. Our patient 1, however, did not respond to 0.2% pilocarpine. Therefore, there was no denervation supersensitivity in the post-ganglionic parasympathetic nerve fibre after the ciliary ganglion. The most plausible explanation for the mydriasis in our patients is the dysfunction of the pre-ganglionic parasympathetic nerve fibre connecting the ciliary ganglion and the Edinger-Westphal nucleus. It is conceivable that the near reflex is maintained through a different pathway. Dacso et al 1 have divided the Edinger-Westphal nucleus into the rostral and caudal portion, with the rostral portion relating to the light reflex and the caudal portion relating to the near reflex.

Patients with SCA1 present mydriasis and occasionally the absence of a light reflex.4 However, light-near dissociation has not been reported in any of these patients. Gilman et al 5 have reported a postmortem case of SCA1 in which they found neuronal loss and a marked gliosis of the periaqueductal grey matter as well as a neuronal loss of the Edinger-Westphal nucleus. These pathological changes may cause light-near dissociation. Future detailed examinations of the pupillary abnormalities in SCA1 patients are eagerly anticipated.