Article Text
PDF
Abstract
Background and objective Between 5% and 10% of amyotrophic lateral sclerosis (ALS) cases have a family history of the disease, 30% of which do not have an identifiable underlying genetic cause after a comprehensive study of the known ALS-related genes. Based on a significantly increased incidence of ALS in a small geographical region from Spain, the aim of this work was to identify novel ALS-related genes in ALS cases with negative genetic testing.
Methods We detected an increased incidence of both sporadic and, especially, familial ALS cases in a small region from Spain compared with available demographic and epidemiological data. We performed whole genome sequencing in a group of 12 patients with ALS (5 of them familial) from this unique area. We expanded the study to include affected family members and additional cases from a wider surrounding region.
Results We identified a shared missense mutation (c.1586C>T; p.Pro529Leu) in the cyclic AMP regulated phosphoprotein 21 (ARPP21) gene that encodes an RNA-binding protein, in a total of 10 patients with ALS from 7 unrelated families. No mutations were found in other ALS-causing genes.
Conclusions While previous studies have dismissed a causal role of ARPP21 in ALS, our results strongly support ARPP21 as a novel ALS-causing gene.
- ALS
- MOTOR NEURON DISEASE
- GENETICS
- FRONTOTEMPORAL DEMENTIA
- EPIDEMIOLOGY
Data availability statement
Data are available upon reasonable request.
This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.
Statistics from Altmetric.com
WHAT IS ALREADY KNOWN ON THIS TOPIC
Between 5% and 10% of amyotrophic lateral sclerosis (ALS) cases have a family history of the disease. 30% of familial ALS cases do not have an identifiable underlying genetic cause after a comprehensive study of the known ALS-related genes. Incidence rates of ALS are fairly homogeneous across European and American populations.
WHAT THIS STUDY ADDS
This work supports the causative role of cyclic AMP regulated phosphoprotein 21 (ARPP21) in ALS and adds to the extensive list of RNA-binding proteins involved in ALS pathophysiology. Further studies are required to elucidate the contribution and frequency of this variant in ARPP21 to the genetic basis of the disease. Peaks of incidence of the disease in small geographical areas may help identify the underlying genetic causes of ALS.
HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY
ARPP21 should be reclassified as an ALS-causing gene, and included in genetic screenings along with other known genes.
Introduction
Amyotrophic lateral sclerosis (ALS) is a devastating motor neuron disease, characterised by muscle weakness and atrophy secondary to upper and lower motor neuron degeneration, leading to respiratory insufficiency and death within a mean of 3–5 years.1 Over the last decades, an evident overlap of clinical, genetic and neuropathological features has been established between ALS and frontotemporal dementia (FTD).2–5
Although most cases are considered sporadic (sALS), approximately 5–10% of ALS cases have a previous family history of ALS and are classified as familial ALS (fALS).6 To date, over 40 genes have been related to ALS, most showing a Mendelian autosomal dominant inheritance pattern. Several ALS-causing mutations have an impact on genes encoding RNA-binding proteins, such as transactive response DNA-binding protein 43 (TDP-43), fused in sarcoma (FUS) and T cell-restricted intracellular antigen-1 (TIA1), among others, highlighting the central role of RNA metabolism in the disease.7 However, despite the rapidly growing number of ALS-related genes, genetic diagnosis remains elusive in approximately 30% of patients with fALS.8 9 The disease has a complex genetic architecture, and oligogenic and polygenic models of inheritance have gained relevance.10 In this era of protein-targeted therapies and genetically oriented treatments, discovery and detection of new genetic variants and implicated genes is paramount.10
Prospective, population-based studies show that incidence rates of ALS are relatively uniform across European and American populations, ranging between two and three cases per year per 100 000 inhabitants.11 12 Peaks of incidence in small regions, especially when several cases aggregate in a family, might suggest the disorder has an underlying genetic substrate.13
Here we report the identification of a mutation in the cyclic AMP-regulated phosphoprotein 21 (ARPP21) gene, supporting its role as a novel ALS-causing gene and expanding the repertoire of RNA-binding proteins associated with ALS. We describe the clinical phenotype of 10 patients from 7 unrelated families carrying the same mutation in ARPP21.
Materials and methods
Case selection and study design
Since 1998 our register has prospectively included cases of ALS seen at the Motor Neuron Clinic at the Neuromuscular Diseases Unit of Hospital Sant Pau (Barcelona), a national referral centre for neuromuscular diseases. Between 2009 and 2022 we observed an unusual number of cases of ALS (especially familial cases) at our outpatient clinic, from a small region in the province of La Rioja in Spain. Figure 1 illustrates the study design.
Flowchart indicating the steps followed in the study and the number of patients at each phase. ALS, amyotrophic lateral sclerosis; ARPP21, cyclic AMP regulated phosphoprotein 21; fALS, familial ALS; MND, motor neuron disease; WGS, whole genome sequencing.
For epidemiological justification (figure 1 – box 1) we reviewed our database and contacted neurology departments from local centres in the region. Eligible population: We selected new cases with diagnosis of ALS from the region, visited between January 2009 and December 2022.
Study population: For genetic analysis (figure 1 – box 2) we selected cases from the study area (see figure 2) with available DNA samples, performing whole genome sequencing (WGS). Patients fulfilled ALS-El Escorial revised criteria for probable, probable laboratory-supported, or definite ALS.14 Both sporadic and fALS cases were included. fALS was defined as having a family member with a diagnosis of ALS in first or second-degree relatives, or having a first-degree family member with a confirmed FTD in the formal neuropsychological examination, according to current proposed criteria.6 All patients went through a targeted ALS-gene panel prior to WGS (online supplemental table 1 in supplementary materials). Patients with a previously identified ALS-causing mutation in this custom panel were excluded from this part of the study (WGS analysis), as they already had a known underlying genetic substrate for the disease.
Supplemental material
(A) Map of Spain and its regions. (B) Map of La Rioja province and its regions. Regions belonging to the south-eastern area of La Rioja, where an increased frequency of amyotrophic lateral sclerosis cases was detected, are shaded in green. White dots mark the location on the map of the six towns of origin of the seven families.
After identifying the candidate variant, we expanded the analysis with the aim of increasing the series of mutation carriers. We performed Sanger sequencing in other cases of sALS and fALS from the surrounding geographical areas and also in their affected family members (figure 1 – box 3). In cases carrying the candidate variant, mutations in other known ALS-FTD genes were ruled out through exome sequencing (see online supplemental table 1 in supplementary materials).
Demography and epidemiology
The expected number of cases in the area during the study period was calculated using incidence rates from previous studies and demographic data of those in the catchment area over 18 years.
Demographic information on the geographical region was obtained from the official demographic records between 2009 and 2022 in the Spanish National Institute of Statistics (INE—Instituto Nacional de Estadística).15 16
The minimum incidence was calculated using the numbers of new cases identified from the area and the population at risk in the study period. We compared the observed cases with the expected number of cases in the area, to obtain a ratio.
Clinical features
We recorded demographic and clinical variables. Demographic data included sex, date and place of birth and place of origin of the family. Clinical variables included age at disease onset, disease duration, region of onset of motor symptoms (spinal or bulbar). The clinical phenotype was categorised depending on the presence of upper (primary lateral sclerosis), lower motor neuron signs (progressive muscular atrophy) or both (ALS). The presence of cognitive and/or behavioural impairment and whether or not they met clinical criteria for FTD and its variants, were also noted.17–19
Family history
We recorded previous cases of ALS in the family as part of the routine clinical evaluation. As possible indicators of an underlying FTD we also recorded previous history of FTD, early-onset cognitive impairment (defined as younger than 65 years of age at symptom onset), cognitive impairment with marked behavioural impairment but no definite diagnosis, and diagnosis of other neurodegenerative diseases.
Genetic analyses
Library preparation and sequencing
WGS was performed at the National Centre for Genomic Analysis (Centro Nacional de Análisis Genómico—CNAG-CRG, Barcelona, Spain). Paired-end multiplex libraries were prepared following the manufacturer’s instructions. Libraries were loaded to Illumina flow cells for cluster generation prior to producing 150 base read pairs on a NovaSeq 6000 instrument following the Illumina protocol. Image analysis, base calling and quality scoring of the run were processed using the manufacturer’s software Real Time Analysis and followed by generation of FASTQ sequence files.
Bioinformatic and genetic analyses
Reads were mapped to human build GRCh38 with BWA-MEM V.0.7.17.20 Alignment files containing only properly paired, unique mapping reads without duplicates were processed using Picard V.2.20 (http://broadinstitute.github.io/picard/) to add read groups and to remove duplicates. The Genome Analysis Tool Kit (GATK V.4.1.9.0)21 was used for local realignment and base quality score recalibration. Joint variant calling was done using HaplotypeCaller, CombineGVCFs and GenotypeGVCFs from GATK following the GATK best practices pipeline. Variants were hard filtered using GATK VariantFiltration (BaseQRankSum>4.0 || BaseQRankSum<−4.0, FS>60,000, FS>200,000, ReadPosRankSum<−8.0, ReadPosRankSum>20.0, MQRankSum<−12.5, QD<2.0, MQ<40.0). We also retained variants where at least one sample contained the variant with a Depth ≥10.
Functional annotations were added using SnpEff V.5.0 with the hg38.22 Variants were annotated with SnpSift V.5.023 using population frequencies, conservation scores and deleteriousness predictions from dbNSFP V.4.1a.24 We also used other sources of annotations, such as gnomAD (V.3.1.2), CADD (V.1.6), InterVar and Clinvar (V.20200602).25–27 In order to check the frequency of the ARPP21 variant in the Spanish population, we used the Collaborative Spanish Variant Server which comprises exomes and genomes from 2105 unrelated Spanish individuals.28
Somalier software29 was used with WGS and whole exome sequencing (WES) data to assess relatedness among all probands included in the study (coefficient of relationship as a measure of the degree of consanguinity). Briefly, the software considers for each comparison: (1) the number of sites where one sample is hom-ref and another is hom-alt; (2) the number of sites where the samples have the same genotype; (3) the number of sites where both samples are heterozygotes; and (4) the number of sites where both samples are homozygous alternate.
WGS data was used to identify shared genotypes that might suggest a common haplotype in the four mutation carriers with available WGS data. A merged VCF file of ARPP21 gene ±1 megabase combining variants from the four patients was obtained to explore shared blocks of genotypes. LDhap web-based tool (https://ldlink.nih.gov/?tab=ldhap) was used to obtain specific population haplotype frequencies of all haplotypes observed for a list of 30 query genetic variants (the maximum accepted as input) flanking the shared ARPP21 candidate variant and part of the shared haplotype (23 of them were available in LDhap). We selected the Iberian population in Spain (IBS) population to obtain allelic frequencies, in addition to the other populations in Europe and all other super populations available (African (AFR), American (AMR), East Asian (EAS) and South Asian (SAS)).
The presence of the disease-causing mutation in ARPP21 was validated using Sanger sequencing in all mutation carriers using the following forward (5’ GACAGTGGTGTGCATCTTGTG 3’) and reverse (3’ GAGACATTCGCACATACCCC 5’) primers.
Once the ARPP21 variant was confirmed, other ALS and FTD causing genes were screened using WES and mutations in 58 ALS-FTD-related genes were ruled out (see online supplemental table 1 in supplementary materials for the complete list of genes). WES was used to study gene coding exons and flanking regions (±50 base pairs). Briefly, DNA libraries were prepared using kapa reagents (Roche) and sequenced in NextSeq 500 or NextSeq 1000 instruments (Illumina) to obtain 2×150 base pair reads. Fastq files were mapped to the human genome using BWA,30 variants were called through GATK variant calling,21 and annotated using ANNOVAR.31 The C9orf72 hexanucleotide repeat expansion was discarded by means of rpPCR (repeat-primed Polymerase Chain Reaction), as previously described.32
Ethics
The study was conducted in accordance with the Declaration of Helsinki. All participants gave their written informed consent to participate in the study.
Results
Epidemiology
The south-eastern region of the province of La Rioja is a 1219.42 km2 area in north-eastern Spain (figure 2). Between 2009 and 2022, it had a mean population of 43 433, of whom 31 324 were over 18 years of age. The population density was 35.62 persons/km2. Figure 1 illustrates the study design and flowchart of patients studied in each phase.
Considering a mean ALS incidence of 1.4–2.47 cases/100 000 person/year,11 12 we calculated an expected number of cases of 0.44–0.77 cases per year in this area, equivalent to 5–10 patients during the study period (2009–2022). In reference to fALS, assuming a frequency of 5–10% of fALS, the expected number of cases in the area would be 0.02–0.08 cases/year or one new case every 12.5–50 years.
Between 2009 and 2022, we visited 15 patients from the study area who met the diagnostic criteria for ALS. 7 of the 15 (46.6%) had a family history of ALS and were considered as fALS. In fALS cases, known ALS-causative mutations were ruled out through exome sequencing analysis or a custom gene panel.
The comparison between the observed frequency and the expected frequency resulted in an increased frequency of ALS cases in the area, with a ratio of 1.5–2.6 for total ALS cases and 7–24.5 for fALS cases.
12 of the 15 patients were eligible for further genomic analysis. One patient was excluded from this part of the study because an alternative genetic cause was found (non-sense pathogenic mutation in NEK1—c.3107C>G; p.Ser1036X—NM_001199397.3). No DNA was available for analysis in the remaining two patients.
Genetics
Detection of the ARPP21 mutation
WGS was performed in 12 unrelated patients (5 fALS and 7 sALS). We found a shared heterozygous missense mutation in ARPP21 (c.1586C>T; p.Pro529Leu (NM_001385486.1 or ENST00000417925.5)) in four unrelated patients with ALS (three fALS) from four different families (figure 3—Families 1–4) (table 1). The high frequency of this almost unique variant, together with its predicted deleteriousness (CADD_phred=26.7; Polyphen HDIV and HVAR=Deleterious and Mutation Taster=Deleterious) and high GERP (Genomic Evolutionary Rate Profiling) score (6.07), which predicted a huge evolutionary constraint, led us to prioritise this variant in ARPP21 as a potential causative mutation. The coefficients of the relationship obtained using Somalier suggest that the probands with available WGS and WES data are unrelated (data not shown). This variant is absent in the population database gnomAD (V.3.1.2) and carried by 4 out of 1 384 130 chromosomes in the latest updated version of gnomAD (V.4.0.0), where the mutation is annotated as p.Pro563Leu (NM_001385562.1 or ENST00000684406.1). We did not find any mutation carrier among the 2105 unrelated Spanish individuals included in the Collaborative Spanish Variant Server.28
Family trees of the seven families in which the p.Pro529Leu mutation in ARPP21 was detected. Patients with ALS are shaded in black. Cases presenting an early onset dementia or dementia with prominent behavioural features are marked with a red square at the top right corner. The proband in each family is marked with an arrow and a ‘P’. Cases that harbour the p.Pro529Leu mutation in ARPP21 are outlined in red and marked with an asterisk. The healthy individual (Family 4— II.3) with negative genetic testing is framed in a green box. No DNA was available from the other patients with ALS or patients with early-onset cognitive-behavioural impairment in the pedigrees. ALS, amyotrophic lateral sclerosis; ARPP21, cyclic AMP regulated phosphoprotein 21; FTD, frontotemporal dementia.
Clinical features of patients with ALS carrying the ARPP21 mutation
Our analysis disclosed a common haplotype shared by the four mutation carriers with available WGS data, which included 442 SNPs (Single Nucleotide Polymorphisms), encompassing 256 Kb (chr3:35605944–35862077). This haplotype was also found in WGS data from two of the eight non-mutation carriers included in this study. We further assessed its frequency in the general population using LDhap. The frequency of the haplotype in the IBS was 7.48%, the same as in the Toscani in Italy. Interestingly, this haplotype was observed at a higher frequency in the British in England and Scotland (GBR) population (11.5%) or at a lower frequency in the Finnish in Finland population (5.6%). The haplotype was almost absent in AFR or EAS populations (<1%), and at low frequencies in the ad mixed AMR population (2.7%). Notably, 9% of the SAS population carried this haplotype.
Expanded study in the region
We subsequently broadened the analysis to affected family members of mutation carriers (hence new fALS cases) and other new patients with sALS and fALS from a wider surrounding geographical area.
Using Sanger sequencing we analysed 22 new patients with ALS, 8 of whom were fALS. We found the candidate variant in 6 novel individuals: 1 affected relative in Family 2, and 5 more cases from 4 unrelated families, resulting in a final count of 10 ARPP21 mutation carriers from 7 unrelated families (see pedigrees in figure 3). We were able to study only one unaffected family member (Family 4—II.3), who did not harbour the candidate variant. We did not find any patient with ALS among the families who did not carry the candidate variant in ARPP21.
Other ALS-FTD-related mutations were ruled out through WES, including the p.Arg92Cys variant in GLT8D1 (see online supplemental table 1). No other rare variants were found in the GLT8D1 gene in ARPP21 mutation carriers. In the proband of Family 5 (III.11), we detected a heterozygous variant in SQSTM1 (c.1175C>T; p.Pro392Leu), for which there is no consensus regarding its pathogenicity for ALS-FTD. The rare variant in SQSTM1 was not carried by his affected family member (Family 5—IV.1) who also carried the mutation in ARPP21 described in this study, thus demonstrating that did not segregate with disease and making any potential association with ALS unlikely.
Clinical features and family history
Table 1 shows the main clinical features of the series. Five patients were men (50%). The mean age at onset was 59.5 years (SD 11.37) and the mean disease duration was 16 months (SD 7.96). At the date of publication, three patients (30%) were alive. The region of onset was bulbar in two patients (20%) and spinal in the others (n=8; 80%). The clinical phenotype was classic ALS (ie, presence of upper and lower motor neuron signs) in all 10 patients (100%), with no cases of progressive muscular atrophy or primary lateral sclerosis in the series. Cognitive-behavioural impairment was present in one patient (10%).
Regarding family history, only one patient did not have a family history of ALS, but had a younger sibling with an early onset dementia (Family 4 in figure 3). Moreover, two other families (Families 5 and 7 in figure 3) had a family history of early-onset dementia.
Pedigrees and case descriptions
Table 1 summarises the main clinical features of the series. Figure 3 shows the family trees.
Family 1
Proband (II.1) presented with progressive paraparesis in their late 40s, with diffuse upper motor neuron signs. Family history was notable for a younger sibling (II.4) who had died from ALS in their 30s, and was hence diagnosed with fALS, with initial negative genetic testing, dying of respiratory insufficiency within 13 months from symptom onset. No clinical information was available concerning the proband’s parents.
Family 2
Proband (III.1) was a patient in their late 30s with a family history of ALS in the grandfather on the father’s side (I.1) and in three of his aunts (II.2; II.6; II.8). The patient presented with spinal onset ALS and died within 16 months from symptom onset. Conventional genetic testing was negative but the heterozygous variant in ARPP21 was identified. A cousin (III.3) was diagnosed with ALS and carries the ARPP21 variant.
Family 3
Proband (II.2) is an adult patient with no relevant medical history, but a family history of a brother (II.4) who died of spinal onset ALS. There were no medical records available for their parents. The patient was diagnosed with ALS in their late 60s following progressive distal upper and later lower limb weakness. Despite the slow progression of the disease, neurophysiological testing confirmed a motor neuron disease. At the time of publication of the present work, the patient was alive.
Family 4
Proband (II.1) was a patient in their 60s who presented with a sporadic, bulbar onset ALS, with a disease duration of 3 years. The patient showed profuse behavioural and cognitive impairment, suggestive of an ALS-FTD, but no formal neuropsychological testing was available.
A younger brother (II.2) had been diagnosed with an early-onset dementia before 65 years of age, but no formal cognitive-behavioural evaluation was performed. Both their parents had died from unknown causes before 60 years of age. No further detailed information was available on their family. The patient’s younger sibling (II.3), older than 70 years of age, who showed no signs or symptoms suggestive of motor neuron disease, was genetically tested and did not harbour the ARPP21 mutation.
Family 5
Proband (III.11) was an elderly patient with an unremarkable personal medical history. This patient presented with a bulbar onset motor neuron disease with progressive limb weakness and respiratory failure, leading to death within 16 months.
There was a profuse history of ALS in the family (see family tree: II.3, II.8, III.4, III.7, III.10, IV.1, IV.6). Furthermore, an uncle of the proband (II.6), whose son and granddaughter died of ALS and was hence an obligate carrier, was diagnosed with unspecified dementia and died before 50 years of age. After the ARPP21 mutation was detected in the proband, the only affected family member (IV.1) with available DNA was retrospectively confirmed to harbour the same mutation.
Family 6
Proband (III.3) was a patient in their late 60s, with a family history of two cases of ALS (III.2, II.2). The proband developed progressive paraparesis evolving to upper limb weakness and dysphagia, and neurophysiological examinations compatible with ALS. At the time of submission of this work, the patient was alive.
Family 7
Proband (III.3) was an adult in their 60s who presented with a rapidly progressive tetraparesis, followed by respiratory insufficiency and death within the first 4 months of disease onset. The patient’s brother (III.2) died of ALS 10 years prior to the proband’s diagnosis, and was retrospectively confirmed to carry the ARPP21 mutation. A cousin (III.5) was also diagnosed with early-onset dementia before 60 years of age. Their father died of pancreatic cancer in his early 70s.
Discussion
Following an increased frequency of cases in the small region of the south-eastern La Rioja province in Spain, we identified the p.Pro529Leu mutation in ARPP21 in 10 patients from 7 unrelated families, showing a presumably autosomal dominant pattern. Familial cases (ie, fALS) accounted for almost 50% of the total cases from the area, none of whom harboured any other known ALS-causing mutations.
From a clinical point of view, patients carrying the p.Pro529Leu variant presented a shorter survival (mean 16 months) than that described in the literature for ALS,12 with no differential clinical features. Although no systematic cognitive assessment was performed, one patient showed prominent cognitive and behavioural impairment. Furthermore, three relatives (one of them an obligate carrier— Family 5 II.6) from different families had been diagnosed with early-onset dementia with marked behavioural symptoms, but no apparent motor neuron disease. It cannot be ruled out that the ARPP21 mutation could also be related to FTD, and clinical presentation at any point might fall within the ALS-FTD spectrum (ie, ALS, FTD or ALS-FTD), as has been observed in other ALS-FTD-related genes.33 Unfortunately, no formal cognitive testing, neuroimaging or DNA samples were available from these patients. Further studies will be required to confirm this hypothesis.
In 2019, Cooper-Knock et al34 described the segregation of a mutation (p.Arg92Cys) in the glycosyltransferase 8 domain-containing protein 1 (GLT8D1) gene and the mutation described in the present study (p.Pro529Leu mutation in ARPP21) in an autosomal dominant ALS pedigree from the UK. Additional screening of both genes in 103 ALS cases disclosed 4 new GLT8D1 mutation carriers, 3 of which also harboured the p.Pro529Leu mutation in ARPP21. However, after a rare variant burden analysis in the Project MinE data set, the authors prioritised mutations in the glycosyltransferase domain of GLT8D1 as causative, suggesting only a secondary and putative synergistic effect for the mutation in ARPP21 in double-mutation carriers. This conclusion was based on an observed shorter disease duration in patients carrying both mutations (<16 months),34 similar to that of patients in our series who carry the p.Pro529Leu variant in isolation. Therefore, we show that the mutation described in our study is sufficient to cause ALS, and suggest that the shorter disease duration might be independently attributed to the p.Pro529Leu mutation in ARPP21.
Interestingly, the four mutation carriers identified through our WGS approach shared a common haplotype. This haplotype was present in two of the eight non-mutation carriers in our study with available WGS data, and it is also found in other worldwide populations. In this context, beyond the Spanish population, its high frequency in the GBR and SAS populations, together with the fact that this haplotype is found at very low frequencies in AMR, AFR or EAS populations, suggests that people carrying this mutation might be restricted to specific ancestries. In this sense, the ARPP21 mutation, although not definitely linked to ALS, has previously been detected in patients of European ancestry, primarily from UK,34 which is part of the GBR population. Indeed, the haplotype is almost null in the EAS population, which might explain why this mutation has not been found in large cohort studies from China35 and Australia34 36 that have previously described other rare variants in ARPP21 or GLT8D1, but were unable to confirm their pathogenic role. Large ALS cohorts have been previously used to identify novel disease-causing variants, such as those included in project MiNE which comprises samples from diverse countries across the world (from Spain, but also Brazil, the USA, Australia and Russia, among others). As demonstrated by the differences in the presence of the ARPP21 risk haplotype around the world, using such diverse populations may have precluded the identification of extremely rare disease-causing variants using rare genetic burden association analyses. It is important to note that our approach was based on the identification of a higher than expected burden of ALS cases in a remote region. For this reason, we implemented a unique strategy that diverged from previously used methods.
To date, the most recent reviews on the genetics of ALS do not consider ARPP21 to be an ALS-causing gene,8 nor was it included in a recent study comprising a set of 90 ALS-associated genes selected from multiple databases.37 In addition, an OMIM number has not yet been assigned to the ARPP21 gene, and in the ALS Online Database (ALSoD; https://alsod.ac.uk)38 the gene is still categorised as ‘tenuous evidence’, meaning that it has been associated with ALS in small studies that have not stood up to replication. Our study demonstrates that ARPP21, or at least the p.Pro529Leu mutation in this gene, is consistently associated with ALS and should be considered in future genetic studies.
The ARPP21 protein is an RNA-binding protein widely expressed in the human brain39 and based on the results of our study, adds to the long list of RNA-binding proteins implicated in ALS, such as TDP-43, TIA1 or FUS. It is involved in RNA metabolism, an event known to be deregulated and central to ALS pathophysiology.40 Importantly, a common set of ARPP21 target RNAs with related functions have been identified through iCLIP. These RNAs have a prominent role in messenger RNA splicing and processing as previously demonstrated by gene ontology enrichment analyses.39 In addition, in cells expressing ARPP21 treated with stress inductors (arsenite, clotrimazole or heat shock), the recruitment of ARPP21 to stress granules is induced. Importantly, the C-terminal sequence of the protein (where the p.Pro529Leu mutation is located) is necessary and sufficient to induce its recruitment to these membraneless dynamic structures. Although its domains have not been fully characterised, the mutation described in our study (p.Pro529Leu) is located in the C-terminal sequence and in close proximity to an intrinsically disordered region with compositional bias to Proline residues (low-complexity regions) of ARPP21. We speculate that this mutation might result in an increased propensity of ARPP21 to interact with and localise to stress granules, a mechanism previously described in ALS-related mutations in other RNA-binding proteins such as FUS,41 TIA142 or TDP-43, and directly related to the pathophysiology of ALS43 and other neurodegenerative diseases.44 Thus, beyond the implication of ARPP21 in RNA metabolism and processing, we suggest that this mutation could alter the dynamics of stress granules by increasing their aberrant formation and thus impacting on ALS pathogenesis.
Our study has some limitations. First, although our results suggest the causal role of the mutation described herein, DNA was available and genetic testing was consented to only in a few family members, thus precluding a complete segregation study. Given the variability in the age of onset of the disease, segregation analysis, especially involving some of the younger asymptomatic relatives, should be interpreted cautiously. Nevertheless, we strongly believe that the presence of the same variant in 10 patients with ALS (9 fALS) from 7 unrelated families in a small geographical area with a high incidence of ALS is a strong argument in favour of its pathogenicity. Further studies are required both in our country and worldwide to elucidate the contribution and frequency of this and other variants in ARPP21 to the genetic basis of the disease, as well as functional validation of the mutation pathogenicity. Second, clinical information on patients’ families was collected retrospectively and was often incomplete, especially regarding cognitive and behavioural symptoms, for which specific standardised cognitive-behavioural tests could have provided a wider phenotypical spectrum of the variant.
In conclusion, our results support the causative role of a mutation (p.Pro529Leu) in ARPP21 in ALS. This work provides robust epidemiological and genetic arguments in favour of mutation pathogenicity. We also discuss disease-causing mechanisms associated with the mutation, supporting the role of ARPP21 as an independent, novel ALS-causing gene, adding to the complex genetic architecture of the disease and expanding the landscape of RNA-binding proteins altered in ALS.
Data availability statement
Data are available upon reasonable request.
Ethics statements
Patient consent for publication
Ethics approval
This study involves human participants and was approved by Hospital de la Santa Creu i Sant Pau Ethics Comittee (Study ID: 20/016 HSCSP). Participants gave informed consent to participate in the study before taking part.
Acknowledgments
We are indebted to patients and their families for their cooperation in the study. We thank Carolyn Newey for her help with language supervision and correction, which greatly improved the quality of our work. This work is generated within the European Reference Network for Neuromuscular Diseases.
References
Supplementary materials
Supplementary Data
This web only file has been produced by the BMJ Publishing Group from an electronic file supplied by the author(s) and has not been edited for content.
Footnotes
X @Uri713 @SantPauMemory, @@NMDSantPau
OD-I and ÁC contributed equally.
Contributors Study conceptualisation and design: OD-I, ÁC, IJ, EG and RR-G were actively involved in study conceptualisation and design. Data acquisition, analysis and interpretation: OD-I, ÁC, OB-M, EÁ-S, MALP, SB, BR-S, IC, JT-S, MC-T, MC-Á, AV, LL, IP-L, LT, NV-T, LM, RR-G. Drafting and critical revision: OD-I, ÁC, BR-S, JT-S, MC-T, MC-Á, AV, LL, IP-L, LT, NV-T, LM, SR-G, II-G, EC-V, EG and RR-G. Study guarantors: RR-G, OD-I.
Funding This study was funded by the Instituto de Salud Carlos III (Ministerio de Asuntos Económicos y Transformación Digital, Gobierno de España) through the projects PI19/01543, PI23/00845 to RR-G, and PI18/00326, PI21/01395 to OD-I, cofunded by the European Regional Development Fund/European Social Fund (ERDF/ESF), ‘A way to make Europe’/‘Investing in your future’. OD-I receives funding from the Fundación Española para el Fomento de la Investigación de la Esclerosis Lateral Amiotrófica (FUNDELA - ‘Por un mundo sin ELA’), Fundación HNA (‘Premio Investigación científica de salud’) and the Alzheimer’s Association (AARF-22-924456). II-G is a senior Atlantic Fellow for Equity in Brain Health at the Global Brain Health Institute (GBHI), and receives funding from the GBHI, the Alzheimer’s Society (GBHI ALZ UK-21-720973) and the Alzheimer’s Association (AACSF-21-850193). II-G was also supported by the Juan Rodés Contract (JR20/0018) and PI21/00791 from Instituto de Salud Carlos III (Ministerio de Asuntos Económicos y Transformación Digital, Gobierno de España).
Map disclaimer The inclusion of any map (including the depiction of any boundaries therein), or of any geographical or locational reference, does not imply the expression of any opinion whatsoever on the part of BMJ concerning the legal status of any country, territory, jurisdiction or area or of its authorities. Any such expression remains solely that of the relevant source and is not endorsed by BMJ. Maps are provided without any warranty of any kind, either express or implied.
Competing interests None declared.
Provenance and peer review Not commissioned; externally peer reviewed.
Supplemental material This content has been supplied by the author(s). It has not been vetted by BMJ Publishing Group Limited (BMJ) and may not have been peer-reviewed. Any opinions or recommendations discussed are solely those of the author(s) and are not endorsed by BMJ. BMJ disclaims all liability and responsibility arising from any reliance placed on the content. Where the content includes any translated material, BMJ does not warrant the accuracy and reliability of the translations (including but not limited to local regulations, clinical guidelines, terminology, drug names and drug dosages), and is not responsible for any error and/or omissions arising from translation and adaptation or otherwise.